| CARD ID | 2200 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6Slc-Tg(NSE-betaCTFV717F) | |
| Internal Code | C105F | |
| Submitter | Akira Kakizuka | |
| Submitter affiliation or code | Graduate School of Biostudies, Kyoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Graduate School of Biostudies, Kyoto University |
| Organization code | ||
| Developer | Akira Kakizuka | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | betaCTF(V717F) |
| Gene name | FLAG-tagged C-terminal portion of human betaCTF with Indiana mutation (V717F) |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| FLAG-C105F | GACTACAAGGACGACGATGACAAGGG |
| C105F-genotyping primer(as) | TGCATCTGCTCAAAGAACTTGTAGG |
| NSE-seq(s) | CAAGGCTGGTCCTCATCCAT |
| NSE-seq(as) | GTCCTCGTCCTCATAGTACT |
| Author | Norio Sasaoka, Megumi Sakamoto, Shoko Kanemori, Michiru Kan, Chihiro Tsukano, Yoshiji Takemoto, Akira kakizuka |
| Title | Long-term Oral Administration of Hop Flower Extracts Mitigates Alzheimer Phenotypes in Mice |
| Journal | PLOS ONE |
| Volume | 9 |
| Page | |
| Year | 2014 |
| PMID |
| Disease name, Applicable field | Neurobiology |