| CARD ID | 2188 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Dbx1tm1(Cre/ERT2) | |
| Internal Code | Dbx1-CreER knock in Mouse | |
| Submitter | Esumi Shigeyuki | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Others
If you use Dbx1-CreER mouse, please contact Dr. Tsutomu Hirata and Dr.Joshua Corbin for MTA. |
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | Dr. Tsutomu Hirata | |
| Year introduced | 2014 / 3 | |
| Introduced Generation | 3 | |
| Remarks | ||
| Gene symbol | Dbx1 |
| Gene name | developing brain homeobox 1 |
| Allele symbol | Dbx1tm1(Cre/ERT2) |
| Allele name | developing brain homeobox 1, targeted mutation 1, |
| MGI | MGI:94867, |
| Chromosome | 7 (31.44) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Cre F | GCGGTCTGGCAGTAAAAACTATC |
| Cre R | GTGAAACAGCATTGCTGTCACTT |
| Author | Hirata T, Li P, Lanuza GM, Cocas LA, Huntsman MM, Corbin JG. |
| Title | Identification of distinct telencephalic progenitor pools for neuronal diversity in the amygdala. |
| Journal | Nature Neuroscience |
| Volume | 2009 |
| Page | 141-149 |
| Year | Feb;12(2): |
| PMID |
| Disease name, Applicable field | Molecular biology, Development, Laboratory-animal Science, Cell biology, Neurobiology, Ophthalomology |