| CARD ID | 2187 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Fezf2tm1 | |
| Internal Code | Fezf2 knock out Mouse | |
| Submitter | Esumi Shigeyuki | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Others
If you use Fezf2 knockout mouse, please contact Dr. Tsutomu Hirata for MTA. |
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | Dr. Tsutomu Hirata | |
| Year introduced | 2014 / 3 | |
| Introduced Generation | 3 | |
| Remarks | ||
| Gene symbol | Fezf2 |
| Gene name | Fez family zinc finger 2 |
| Allele symbol | Fezf2tm1 |
| Allele name | Fez family zinc finger 2, targeted mutation 1 |
| MGI | MGI:1859823, |
| Chromosome | 14 (6.36) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| LacZ F | TGGGTAATAAGCGTTGGCAATTTAAC |
| LacZ R | GATAAATAAGGTTTTCCCCTGATGCTG |
| Author | Hirata-Fukae C, Hirata T. |
| Title | The zinc finger gene Fezf2 is required for the development of excitatory neurons in the basolateral complex of the amygdala. |
| Journal | Dev Dyn. |
| Volume | Aug;243(8) |
| Page | 1030-6. |
| Year | 2014 |
| PMID |
| Author | Hirata T, Nakazawa M, Muraoka O, Nakayama R, Suda Y, Hibi M. |
| Title | Zinc-finger genes Fez and Fez-like function in the establishment of diencephalon subdivisions. |
| Journal | Development |
| Volume | Oct;133(20) |
| Page | 3993-4004 |
| Year | 2006 |
| PMID |
| Disease name, Applicable field | Molecular biology, Development, Laboratory-animal Science, Cell biology, Neurobiology, Ophthalomology |