| CARD ID | 2179 | |
| Type of strain | Targeted mutant. | |
| Strain name | STOCK Fer1l6tm1a(KOMP)Osb/80 | |
| Internal Code | Fer1l6 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Fer1l6 |
| Gene name | fer-1-like 6 (C. elegans) |
| Allele symbol | Fer1l6tm1a(KOMP)Osb/80 |
| Allele name | fer-1-like 6 (C. elegans); targeted mutation 1a, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:3645398, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Fer1l6-both | CCATCATTGCCTCTGCCTTTCT |
| Fer1l6-WT | CCATCATGGATCTTAGTCAGCAGT |
| LAR3 | CACAACGGGTTCTTCTGTTAGTCC |
| Author | Akane Morohoshi, Haruhiko Miyata, Keizo Tokuhiro, Rie Iida-Norita, Taichi Noda, Yoshitaka Fujihara, Masahito Ikawa |
| Title | Testis-enriched ferlin, FER1L5, is required for Ca2+-activated acrosome reaction and male fertility |
| Journal | Sci Adv. |
| Volume | 9(4) |
| Page | |
| Year | 2023 |
| PMID | 36696506 |
| Disease name, Applicable field |