| CARD ID | 2177 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6N-Efcab1tm1a(KOMP)Osb/11 | |
| Internal Code | Efcab1 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Efcab1 |
| Gene name | EF-hand calcium binding domain 1 |
| Allele symbol | Efcab1tm1a(KOMP)Osb/11 |
| Allele name | EF-hand calcium binding domain 1; targeted mutation 1a, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:1914043, |
| Chromosome | 16 (10.09) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| WT-F(#6336) | TCCCAGTACTCCTAGTCACA |
| WT-R(#6380) | GCCACACCTGAAGCCCAAAG |
| Ex52 (#5931) | CACACGCACACGCACACACACACAGAGG |
| LoxP_R (#5083) | ACTGATGGCGAGCTCAGACC |
| Author | Keita Sasaki , Kogiku Shiba , Akihiro Nakamura , Natsuko Kawano , Yuhkoh Satouh , Hiroshi Yamaguchi , Motohiro Morikawa , Daisuke Shibata , Ryuji Yanase , Kei Jokura , Mami Nomura , Mami Miyado , Shuji Takada , Hironori Ueno , Shigenori Nonaka , Tadashi Baba , Masahito Ikawa , Masahide Kikkawa , Kenji Miyado , Kazuo Inaba |
| Title | Calaxin is required for cilia-driven determination of vertebrate laterality |
| Journal | Commun Biol . |
| Volume | 2:226 |
| Page | |
| Year | 2019 |
| PMID |
| Disease name, Applicable field |