| CARD ID | 2170 | |
| Type of strain | Targeted mutant. | |
| Strain name | STOCK Tulp2tm1Osb/3B | |
| Internal Code | Tulp2 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Tulp2 |
| Gene name | tubby-like protein 2 |
| Allele symbol | Tulp2tm1Osb |
| Allele name | tubby-like protein 2; targeted mutation 1, Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University, |
| MGI | MGI:1861600, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| #781 | GCTTGCCGAATATCATGGTGGAAAATGGCC |
| #6165 | GGACTCATATTCCATCCGTAAGGGTGTC |
| #6166 | CTCTGGCATCCGTGGATCCAACC |
| Author | Yuki Oyama , Haruhiko Miyata , Keisuke Shimada , Tamara Larasati , Yoshitaka Fujihara , Masahito Ikawa |
| Title | TULP2 deletion mice exhibit abnormal outer dense fiber structure and male infertility |
| Journal | Reproductive Medicine and Biology |
| Volume | 23;21(1) |
| Page | e12467 |
| Year | 2022 May |
| PMID | 35619658 |
| Disease name, Applicable field |