CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2170
Type of strain Targeted mutant.
Strain name STOCK Tulp2tm1Osb/3B
Internal Code Tulp2 KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Tulp2
Gene name tubby-like protein 2
Allele symbol Tulp2tm1Osb
Allele name tubby-like protein 2; targeted mutation 1, Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University,
MGI MGI:1861600,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
#781 GCTTGCCGAATATCATGGTGGAAAATGGCC
#6165 GGACTCATATTCCATCCGTAAGGGTGTC
PCR Primer 2
#6166 CTCTGGCATCCGTGGATCCAACC


References

Author Yuki Oyama , Haruhiko Miyata , Keisuke Shimada , Tamara Larasati , Yoshitaka Fujihara , Masahito Ikawa
Title TULP2 deletion mice exhibit abnormal outer dense fiber structure and male infertility
Journal Reproductive Medicine and Biology
Volume 23;21(1)
Page e12467
Year 2022 May
PMID 35619658


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.