| CARD ID | 2166 | |
| Type of strain | Targeted mutant. | |
| Strain name | STOCK Ppp3cctm1a(EUCOMM)Osb/12B | |
| Internal Code | Ppp3cc KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ppp3cc |
| Gene name | protein phosphatase 3, catalytic subunit, gamma isoform |
| Allele symbol | Ppp3cctm1(EUCOMM)Osb |
| Allele name | protein phosphatase 3, catalytic subunit, gamma isoform, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University |
| MGI | MGI:107162, |
| Chromosome | 14 (36.30) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Ppp3cc-both | GAGGCTCCGATCACAGGTATGAA |
| Ppp3cc-WT | GGTAGCGAGTATTACTAGGTGATCCC |
| LAR3 | CACAACGGGTTCTTCTGTTAGTCC |
| Author | Miyata H, Satouh Y, Mashiko D, Muto M, Nozawa K, Shiba K, Fujihara Y, Isotani A, Inaba K, Ikawa M. |
| Title | Sperm calcineurin inhibition prevents mouse fertility with implications for male contraceptive. |
| Journal | Science |
| Volume | 350(6259) |
| Page | 442-5 |
| Year | 2015 |
| PMID |
| Disease name, Applicable field |