| CARD ID | 2165 | |
| Type of strain | Targeted mutant. | |
| Strain name | STOCK Lypd4tm1Osb/6A | |
| Internal Code | Lypd4 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Lypd4 |
| Gene name | Ly6/Plaur domain containing 4 |
| Allele symbol | Lypd4tm1Osb |
| Allele name | Ly6/Plaur domain containing 4, targeted mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:2687054, |
| Chromosome | 7 (13.30) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| #719 | GCCTTCTATCGCCTTCTTGACGAGTTCTTC |
| #6156 | CTAGGGATTACTGGCAAGAACGGGG |
| #6157 | GGGTTGACTGGCCTTGAGTCTCAC |
| Author | Yoshitaka Fujihara, Taichi Noda, Kiyonori Kobayashi, Asami Oji, Sumire Kobayashi, Takafumi Matsumura, Tamara Larasati, Seiya Oura, Kanako Kojima-Kita, Zhifeng Yu, Martin M. Matzuk, and Masahito Ikawa |
| Title | Identification of multiple male reproductive tract-specific proteins that regulate sperm migration through the oviduct in mice |
| Journal | Proc Natl Acad Sci U S A. |
| Volume | 116(37) |
| Page | 18498-18506 |
| Year | 2019 |
| PMID |
| Disease name, Applicable field |