| CARD ID | 2157 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Zcchc13tm1Osb/24 | |
| Internal Code | Zcchc13 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Zcchc13 |
| Gene name | zinc finger, CCHC domain containing 13 |
| Allele symbol | Zcchc13tm1Osb |
| Allele name | zinc finger, CCHC domain containing 13 , targeted mutation 1, Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| MGI | MGI:1922314, |
| Chromosome | X (46.26) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| #719 | GCCTTCTATCGCCTTCTTGACGAGTTCTTC |
| #5836 | GTCACAGAGGCCTGCCAGG |
| #5837 | GCCATTCTCACCACATCTGTAGCAC |
| Author | Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D, Kriseman ML, Mashiko D, Matsumura T, Matzuk RM, Mori M, Noda T, Oji A, Okabe M, Prunskaite-Hyyrylainen R, Ramirez-Solis R, Satouh Y, Zhang Q, Ikawa M, Matzuk MM. |
| Title | Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice. |
| Journal | Proc Natl Acad Sci U S A. |
| Volume | 113(28) |
| Page | 7704-10 |
| Year | 2016 |
| PMID | 27357688 |
| Disease name, Applicable field |