| CARD ID | 2154 | |
| Type of strain | Targeted mutant. | |
| Strain name | STOCK Adam3tm1(KOMP)Osb/11B | |
| Internal Code | Adam3 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Adam3 |
| Gene name | a disintegrin and metallopeptidase domain 3 |
| Allele symbol | Adam3tm1(KOMP)Osb |
| Allele name | a disintegrin and metallopeptidase domain 3 , targeted mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:102518, |
| Chromosome | 8 (13.09) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| #5319 | ATCCGGGGGTACCGCGTCGAG |
| #6042 | ACAGCTCACTCCATTGCATTTGCC |
| #6043 | CTGGTTAGCACACAAGCAAAGGGG |
| Author | Fujihara Y, Oji A, Kojima-Kita K, Larasati T, Ikawa M. |
| Title | Co-expression of sperm membrane proteins CMTM2A and CMTM2B is essential for ADAM3 localization and male fertility in mice. |
| Journal | J Cell Sci |
| Volume | 2018 Oct 8;131(19) |
| Page | pii: jcs221481. doi: 10.1242/jcs.221481. |
| Year | 2018 |
| PMID |
| Disease name, Applicable field |