| CARD ID | 2150 | |
| Type of strain | Targeted mutant. | |
| Strain name | STOCK Plac1tm1(KOMP)Osb/2 | |
| Internal Code | Plac1 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Plac1 |
| Gene name | placental specific protein 1 |
| Allele symbol | Plac1tm1(KOMP)Osb |
| Allele name | placental specific protein 1, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University |
| MGI | MGI:1926287, |
| Chromosome | X (29.31) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| #5319 | ATCCGGGGGTACCGCGTCGAG |
| #5706 | GTTCACTCAGATGATCTGAGGAAACCC |
| #5707 | ACCCAGGCACCAATGCTAGC |
| Author | Muto M, Fujihara Y, Tobita T, Kiyozumi D, Ikawa M. |
| Title | Lentiviral Vector-Mediated Complementation Restored Fetal Viability but Not Placental Hyperplasia in Plac1-Deficient Mice. |
| Journal | Biol Reprod |
| Volume | 94 (1) |
| Page | 6 |
| Year | 2016 |
| PMID |
| Disease name, Applicable field |