| CARD ID | 2149 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Hhextm1Ngu | |
| Internal Code | B6;129-Hhextm1Ngu | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | ||
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Hhex |
| Gene name | hematopoietically expressed homeobox |
| Allele symbol | Hhextm1Ngu |
| Allele name | hematopoietically expressed homeobox; targeted mutation 1, Tamio Noguchi |
| MGI | MGI:96086, |
| Chromosome | 19 (32.28) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| NCR | AGCAGCCATGGTGCTACAGGGCAAGTCTCTA |
| KS | TCGAGGTCGACGGTATCGATAAGCTTGATA |
| UTR | AGAGGTTTCAGGCACCTAGCGAGCGACTGC |
| Author | Keng VW et al |
| Title | Homeobox gene hex is essential for onset of mouse embryonic liver development and differentiation of the monocyte lineage |
| Journal | Biochem Biophys Res Commun |
| Volume | 5;276(3) |
| Page | 1155-61 |
| Year | 2000 |
| PMID |
| Disease name, Applicable field |