| CARD ID | 2148 | |
| Type of strain | Targeted mutant. | |
| Strain name | STOCK Pdilttm1Osb/70 | |
| Internal Code | Pdilt KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Pdilt |
| Gene name | protein disulfide isomerase-like, testis expressed |
| Allele symbol | Pdilttm1Osb |
| Allele name | protein disulfide isomerase-like, testis expressed, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University |
| MGI | MGI:1919080, |
| Chromosome | 7 (63.90) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| 4484 | atggaactgctttggacacc |
| 4485 | aatactcacggaaaatcacc |
| 114 | ATCTggACgA AgAgCATCAg |
| Disease name, Applicable field |