| CARD ID | 2141 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6D2-Ly6ktm1Osb | |
| Internal Code | Ly6k KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ly6k |
| Gene name | Lymphocyte antigen 6 complex, locus K |
| Allele symbol | Ly6ktm1Osb |
| Allele name | lymphocyte antigen 6 complex, locus K, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University |
| MGI | MGI:1923736, |
| Chromosome | 15 (34.28) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| #719 | GCCTTCTATCGCCTTCTTGACGAGTTCTTC |
| #5577 | GCAAGGCCACTAGGAACGCC |
| #5578 | GGCACGGGCTGCTGAGG |
| Author | Fujihara Y, Okabe M, Ikawa M. |
| Title | GPI-anchored protein complex, LY6K/TEX101, is required for sperm migration into the oviduct and male fertility in mice. |
| Journal | Biol Reprod |
| Volume | 90(3) |
| Page | 60 |
| Year | 2014 |
| PMID |
| Disease name, Applicable field | Others |