| CARD ID | 2140 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6N-Wbp2nltm1a(EUCOMM)Osb | |
| Internal Code | PAWP KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Wbp2nl |
| Gene name | WBP2 N-terminal like |
| Allele symbol | Wbp2nltm1b(EUCOMM)Osb |
| Allele name | WBP2 N-terminal like, targeted mutation 1b, Research Institute for Microbial Diseases,Osaka University |
| MGI | MGI:1921966, |
| Chromosome | 15 (38.56) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| #5438 | GCTTCCTCTGGCTTGCTCAGCTTGCTTTC |
| #5083 | ACTGATGGCGAGCTCAGACC |
| Author | Satouh Y, Nozawa K, Ikawa M |
| Title | Sperm postacrosomal WW domain-binding protein is not required for mouse egg activation. |
| Journal | Biol Reprod |
| Volume | 93(4) |
| Page | 94 |
| Year | 2015 |
| PMID |
| Disease name, Applicable field | Development |