| CARD ID | 2139 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6N-Oosp1tm1a(KOMP)Osb/90 | |
| Internal Code | Oosp1 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Oosp1 |
| Gene name | oocyte secreted protein 1 |
| Allele symbol | Oosp1tm1a(KOMP)Osb/90 |
| Allele name | oocyte secreted protein 1; targeted mutation 1a,Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:2149290, |
| Chromosome | 19 (8.48) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| #5083 | actgatggcgagctcagacc |
| #5436 | taaggatcaggcctacgata |
| #5759 | gtgccgaccactggttccatc |
| #5760 | gcactgttacagcacagcctctc |
| Author | Ferheen Abbasi, Mayo Kodani, Chihiro Emori, Daiji Kiyozumi, Masashi Mori, Yoshitaka Fujihara, Masahito Ikawa. |
| Title | CRISPR/Cas9-Mediated Genome Editing Reveals Oosp Family Genes are Dispensable for Female Fertility in Mice. |
| Journal | Cells |
| Volume | 9(4) |
| Page | |
| Year | 2020 |
| PMID |
| Disease name, Applicable field | Development |