| CARD ID | 2136 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6N-Crisp4tm1a(KOMP)Osb/7E | |
| Internal Code | Crisp4 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Crisp4 |
| Gene name | cysteine-rich secretory protein 4 |
| Allele symbol | Crisp4tm1a(KOMP)Osb/7E |
| Allele name | cysteine-rich secretory protein 4; targeted mutation 1a, Research Institute for Microbial Diseases, Osaka University, |
| MGI | MGI:1925331, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Geno1 | ACCCTCACCTATCCTTGCTGGCAG |
| LAR3 | CACAACGGGTTCTTCTGTTAGTCC |
| Author | Guillermo Carvajal, Nicolás Gastón Brukman, Mariana Weigel Muñoz, María A Battistone, Vanesa A Guazzone, Masahito Ikawa, Miyata Haruhiko, Livia Lustig, Sylvie Breton, Patricia S Cuasnicu |
| Title | Impaired male fertility and abnormal epididymal epithelium differentiation in mice lacking CRISP1 and CRISP4 |
| Journal | Sci Rep. |
| Volume | 8(1) |
| Page | |
| Year | 2018 |
| PMID | 30510210 |
| Disease name, Applicable field | Development |