| CARD ID | 2134 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6D2-Sp56tm1Osb | |
| Internal Code | Sp56 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Zp3r |
| Gene name | zona pellucida 3 receptor |
| Allele symbol | Zp3rtm1 |
| Allele name | zona pellucida 3 receptor, targeted mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:104965, |
| Chromosome | 1 (56.89) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| #3878 | GCCATATGGCATCCACATTTGG |
| #3881 | CCATCTGACCTTTTGGTAGGCTC |
| #2726 | CTTTACGGTATCGCCGCTCCCGATT |
| Author | Muro Y, Buffone MG, Okabe M, Gerton GL. |
| Title | Function of the acrosomal matrix: zona pellucida 3 receptor (ZP3R/sp56) is not essential for mouse fertilization. |
| Journal | Biol Reprod. |
| Volume | 86(1) |
| Page | 1-6 |
| Year | 2012 |
| PMID |
| Disease name, Applicable field |