| CARD ID | 2128 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6N-Crisp2tm1a(KOMP)Osb/6FOsb | |
| Internal Code | B6-Crisp2-tm1a | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | - | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Crisp2 |
| Gene name | cysteine-rich secretory protein 2 |
| Allele symbol | Crisp2tm1a(KOMP)Osb/6FOsb |
| Allele name | cysteine-rich secretory protein 2; targeted mutation 1a, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:98815, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| 5560 | GTGCACATAAGTGTTATTCCTGCTATCTTG |
| 5083 | ACTGATGGCGAGCTCAGACC |
| Author | N G Brukman, H Miyata, P Torres, D Lombardo, J J Caramelo, M Ikawa, V G Da Ros, P S Cuasnicú |
| Title | Fertilization defects in sperm from Cysteine-rich secretory protein 2 (Crisp2) knockout mice: implications for fertility disorders |
| Journal | Mol Hum Reprod. |
| Volume | 22(4) |
| Page | 240-51. |
| Year | 2016 |
| PMID | 26786179 |
| Disease name, Applicable field | Development |