| CARD ID | 2083 | |
| Type of strain | Gene trap. | |
| Strain name | B6;CB-Wdr11Gt(pU-21KBW)205Card | |
| Internal Code | Ayu21-KBW205 | |
| Submitter | Ken-ichi YAMAMURA | |
| Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | IRDA, Kumamoto University |
| Organization code | Card | |
| Developer | Kimi Araki | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Wdr11 |
| Gene name | WD repeat domain 11 |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1920230, |
| Chromosome | 7 , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM | OMIM ID: 0 Human Gene Symbol: WDR11, |
| Z-1 | GCGTTACCCAACTTAATCG |
| Z-2 | TGTGAGCGAGTAACAACCCG |
| Author | Yeon-Joo Kim, et al. |
| Title | WDR11-mediated Hedgehog signalling defects underlie a new ciliopathy related to Kallmann syndrome. |
| Journal | EMBO reports |
| Volume | 19 |
| Page | 269-289 |
| Year | 2018 |
| PMID | 29263200 |
| Disease name, Applicable field | Development, Neurobiology, Reproduction, Otorhinology |
| EGTC番号 | 21-KBW205 |