| CARD ID | 2079 | |
| Type of strain | Transgenic. | |
| Strain name | C.Cg-Tg(Krt19-Wnt1/K19-Ptgs2/K19-Ptges) | |
| Internal Code | BALB-Tg(Krt19-Wnt1/K19-Ptgs2/K19-Ptges), K19-Wnt1/C2mE(BALB) | |
| Submitter | Masanobu Oshima | |
| Submitter affiliation or code | Division of Genetics, Cancer Research Institute, Kanazawa University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Cancer Research Institute, Kanazawa University |
| Organization code | ||
| Developer | Masanobu Oshima | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Wnt1, Ptgs2, Ptges |
| Gene name | Wnt1, COX-2, mPGES-1 |
| Allele symbol | Tg(Krt19-Wnt1/K19-Ptgs2/K19-Ptges) |
| Allele name | transgene insertion |
| MGI | |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| Wnt1F, COX-2-F3 | CGACCGTGTTCTCTGAGATG, CAAACTCAAGTTTGACCCAG |
| HA-R, COX-2-R1 | CATCATATGGGTAGGCCATGG, CTTTTACAGCTCAGTTGAACG |
| Author | Oshima H and Oshima M |
| Title | Mouse models of gastric tumors: Wnt activation and PGE2 induction. |
| Journal | Pathology International |
| Volume | 60 (9) |
| Page | 599-607 |
| Year | 2010 |
| PMID |
| Author | Oshima H, Oguma K, Du YC and Oshima M |
| Title | Prostaglandin E2, Wnt, and BMP in gastric tumor mouse models. |
| Journal | Cancer Science |
| Volume | 100 (10) |
| Page | 1779-1785 |
| Year | 2009 |
| PMID |
| Author | Oshima H, Matsunaga A, Fujimura T, Tsukamoto T, Taketo MM, Oshima M. |
| Title | Carcinogenesis in mouse stomach by simultaneous activation of the wnt signaling and prostaglandin e(2) pathway. |
| Journal | Gastroenterology |
| Volume | 131 |
| Page | 1086-1095 |
| Year | 2006 |
| PMID |
| Disease name, Applicable field | cancer |