| CARD ID | 2068 | |
| Type of strain | Targeted mutant. | |
| Strain name | MSM/Ms-Hnf1btm1Card | |
| Internal Code | MSM/Ms-Hnf1btm1Card | |
| Submitter | Yamamura Ken-ichi | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | Card | |
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Hnf1b |
| Gene name | HNF1 homeobox B |
| Allele symbol | Hnf1btm1Card |
| Allele name | HNF1 homeobox B, targeted mutation 1, Naomi Nakagata |
| MGI | MGI:98505, |
| Chromosome | 11 (51.23) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| sc_5AF4 | AAGGCGCGCCTTGAGACAGGGCTTCATAGAGC |
| neo_108r | CCTCAGAAGAACTCGTCAAGAAG |
| Disease name, Applicable field | Diabetes |