| CARD ID | 2066 | |
| Type of strain | Targeted mutant. | |
| Strain name | MSM/Ms-Hnf1atm1Card | |
| Internal Code | MSM/Ms-Hnf1atm1Card | |
| Submitter | Yamamura Ken-ichi | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | Card | |
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Hnf1a |
| Gene name | HNF1 homeobox A |
| Allele symbol | Hnf1atm1Card |
| Allele name | HNF1 homeobox A, targeted mutation 1, Naomi Nakagata |
| MGI | MGI:98504, |
| Chromosome | 5 (55.99) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| neo_3AR4 | AAGATATCATTTCAAAGGCTGGCATGCG |
| neo_G02 | ATCAGGACATAGCGTTGGCTAC |
| Disease name, Applicable field | Diabetes |