CARD R-BASE



Mouse strain


Strain information

CARD ID 2063
Type of strain Gene trap.
Strain name B6.Cg-Fblim1Gt(Ayu21-T327*mERT2)2Card
Internal Code Fblim1-mERT2,1279
Submitter Masatake ARAKI
Submitter affiliation or code IRDA, Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization IRDA, Kumamoto University
Organization code Card
Developer Masatake Araki
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Fblim1
Gene name filamin binding LIM protein 1
Allele symbol
Allele name
MGI MGI:1921452,
Chromosome 4 ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Cre-1 acatgttcagggatcgccag
Cre-2 taaccagtgaaacagcattgc


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.