| CARD ID | 2026 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Cdh2tm1 | |
| Internal Code | Ncad EDmutant | |
| Submitter | Kinoshita Ayae | |
| Submitter affiliation or code | Kyoto University Graduate School of Medicine Department of Human Health Sciences | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Kyoto University Graduate School of Medicine Department of Human Health Sciences |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Cdh2 |
| Gene name | cadherin 2 |
| Allele symbol | Cdh2tm1 |
| Allele name | cadherin 2, targeted mutation 1, Ayae Kinoshita, Kyoto University |
| MGI | MGI:88355, |
| Chromosome | 18 (10.1) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| CDH2 ED-Fw | AGCATTGGAAATGTAATTGAGC |
| CDH2 ED-Rv | TTGAGCAACTACTGTAAGCC |
| Disease name, Applicable field | Behavior, Molecular biology, Laboratory-animal Science, Cell biology, Neurobiology |