| CARD ID | 2024 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(CAG-Mcm3ap)2Nsa | |
| Internal Code | CAG-GANPTg #2 | |
| Submitter | Nobuo SAKAGUCHI | |
| Submitter affiliation or code | Kumamoto University School of Medicine, Department of Immunoloy | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Mcm3ap |
| Gene name | germinal center-associated nuclear protein |
| Allele symbol | Tg(CAG-Mcm3ap)2Nsa |
| Allele name | transgene insertion 2, Naohiko Sakai |
| MGI | |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| mganp1-5' | TCCCGCCTTCCAGCTGTGAC |
| mganp1-3' | GTGCTGCTGTGTTATGTCCT |
| Disease name, Applicable field | cancer |