CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 1996
Type of strain Transgenic.
Strain name C57BL/6-Tg(Nkx2.1-iCre)/Tama
Internal Code Nkx2.1(Nkx2-1)-iCre
Submitter Esumi Shigeyuki
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Others
If you use Nkx2.1(Nkx2-1)-iCre mouse, please contact Dr.Kesarris Nicoletta for MTA.
Production method From other organizations
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization Wolfson Institute for Biomedical Research University College London
Organization code
Developer Dr.Kesarris Nicoletta
Year introduced 2009 / 12
Introduced Generation 6
Remarks


Gene information

Gene symbol Nkx2.1 synonym of Nkx2-1
Gene name NK2 homeobox 1(Nkx2)
Allele symbol Tg(Nkx2.1-iCre)
Allele name transgene insertion
MGI
Chromosome
Gene classification Gene to express(transgenic)
Method MicroInjection
OMIM

PCR Primer 1
iCre 250s F GAGGGACTACCTCCTGTACC
iCre 800s R TGCCCAGAGTCATCCTTGGC


References

Author Fogarty M, Grist M, Gelman D, Marín O, Pachnis V and Kessaris N.
Title Spatial genetic patterning of the neuroepithelium generates GABAergic interneuron diversity in the adult cortex
Journal Journal of Neuroscience
Volume 27(41)
Page 10935-46
Year 2007
PMID


Disease , Applicable field information

Disease name, Applicable field Neurobiology, Development, Molecular biology, Behavior


EGTC

EGTC番号




Copyright @ 2021 Kumamoto University. All rights reserved.