| CARD ID | 197 | |
| Type of strain | Transgenic. | |
| Strain name | B6;D2-Tg(beta1.4 GalNAc-T)Act32 | |
| Internal Code | , transgenic (beta1.4 GalNAc-T)Act32 | |
| Submitter | Koichi Furukawa | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Dep. of Genetics, Genetic Res. Inst., Kumamoto Univ. |
| Organization code | ||
| Developer | Misao SUZUKI | |
| Year introduced | 1997 | |
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Galgt2? |
| Gene name | beta 1,4GalNAc transferase |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| primerA | AGAGCACTGATGTTGTACTC |
| primerB | AGTCGAGGAGTCGCAGTT |
| Author | Satoshi Fukumoto, Akihito Yamamoto, Tomokazu Hasegawa, Kuniko Abe, Kogo Takamiya, Masahiko Okada, Zhao Jin Min, Keiko Furukawa, Hiroshi Miyazaki, Yoshiro Tsuji, George Goto, Misao Suzuki, Hiroshi Shiku and Koichi Furukawa |
| Title | Genetic remodeling of gangliosides resulted in the enhanced reactions to the foreign substances in skin |
| Journal | Glycobiology |
| Volume | 7 |
| Page | 1111-1120 |
| Year | 1997 |
| PMID | 9455912 |
| Disease name, Applicable field | Physiology, Immunology, Dermatology, Neurobiology |