| CARD ID | 1964 | |
| Type of strain | Gene trap. | |
| Strain name | B6.Cg-Mettl2Gt(Ayu21-W15*mERT2)1Card | |
| Internal Code | Mettl2-mERT2,156 | |
| Submitter | Masatake ARAKI | |
| Submitter affiliation or code | Gene Technology Center, IRDA, Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | Card | |
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Mettl2 |
| Gene name | methyltransferase like 2 |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1289171, |
| Chromosome | 11 , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Cre-1 | acatgttcagggatcgccag |
| Cre-2 | taaccagtgaaacagcattgc |
| Disease name, Applicable field | Others |