| CARD ID | 1933 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Rpt3tm1 | |
| Internal Code | Rpt3 delta | |
| Submitter | Takahashi Ryosuke | |
| Submitter affiliation or code | Department of Neurology kyoto University Graduate School of Medicine | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Department of Neurology kyoto University Graduate School of Medicine |
| Organization code | ||
| Developer | Yoshitaka Tashiro , Ryousuke Takahashi | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Psmc4 |
| Gene name | proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
| Allele symbol | Psmc4tm1 |
| Allele name | targeted mutation 1 |
| MGI | MGI:1346093, |
| Chromosome | 7 (16.11) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| Rpt3fl-for | TGAGCTGTGTATCAAGGTCC |
| Rpt3del-rev | TGCAATCCCTTGTCAGGAGA |
| Author | Tashiro Y, Urushitani M, Inoue H, Koike M, Uchiyama Y, Komatsu M, Tanaka K, Yamazaki M, Abe M, Misawa H, Sakimura K, Ito H, Takahashi R. |
| Title | Motor Neuron-specific Disruption of Proteasomes, but not Autophagy, Replicates Amyotrophic Lateral Sclerosis. |
| Journal | J Biol Chem. |
| Volume | |
| Page | PMID: 23095749 |
| Year | 2012 |
| PMID |
| Disease name, Applicable field | Respiratory System, Physiology, Anatomy, Aging, Behavior, Pharmacology, Molecular biology, Development, Laboratory-animal Science, Cell biology, Genetics, Immunology, Chromosome aberration, Obesity, Diabetes, infectious, cancer, Urology, peromelia, Dermatology, Neurobiology, Endocrine Disorders, Metabolism, Reproduction, Digestive Disorders, Hematology, Otorhinology, Dentistry, Osteosis, Ophthalomology |