| CARD ID | 1923 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;CB-Cdca3tm1 | |
| Internal Code | Cdca3-KO | |
| Submitter | Kato Masashi | |
| Submitter affiliation or code | Nagoya University Graduate School of Medicine Department of Occupational and Environmental Health | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Cdca3 |
| Gene name | Cell division cycle associated 3 |
| Allele symbol | Cdca3tm1 |
| Allele name | targeted mutation 1, Masashi Katoh, Nagoya University, School of Medicine |
| MGI | MGI:1315198, |
| Chromosome | 6 (59.17 ) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| pr0529 | TTACCGTGCCTGGCAACTTTC |
| pr0762 | GAAGGGGAGAACTGACTCCCTCAA |
| Disease name, Applicable field | Unknown |