| CARD ID | 1895 | |
| Type of strain | Transgenic. | |
| Strain name | FVB-Tg(hPRSS8)47870/Card | |
| Internal Code | FVB Tg hPRSS8-47870 | |
| Submitter | - - | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Department of Molecular Biology and Microbiology, and Biomolecular Science Center, University of Central Florida, Orlando, Florida |
| Organization code | ||
| Developer | Karl X. Chai | |
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | hPRSS8 |
| Gene name | human prostasin |
| Allele symbol | |
| Allele name | transgene insertion, Karl X. , Department of Molecular Biology and Microbiology, and Biomolecular Science Center, University of Central Florida |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| H. pro-rat-kpnl-s | 5CTCCTCCAACTCAGCAGACC |
| Human PRSS8 RT-PCR-A | 5GAGAGATGTGCTCATCAGTCTGG |
| Author | Li-Mei Chen, Cindy Wang, Mengqian Chen, Matthew R. Marcello, Julie Chao, Lee Chao and Karl X. Chai |
| Title | Prostasin attenuates inducible nitric oxide synthase expression in lipopolysaccharide-induced urinary bladder inflammation |
| Journal | Am J Physiol Renal Physiol |
| Volume | 291 |
| Page | F567-F577 |
| Year | 2006 |
| PMID |
| Disease name, Applicable field | Unknown |