| CARD ID | 1891 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;CB-Hmga1tm1(Hmga1-EGFP-IRES-neo)IN3Imeg | |
| Internal Code | HMGA1-EGFPIN3 | |
| Submitter | Nakao Mitsuyoshi | |
| Submitter affiliation or code | Department of Medical Cell Biology Director, Institute of Molecular Embryology and Genetics Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
No condition
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University |
| Organization code | Imeg | |
| Developer | Mitsuyoshi Nakao | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Hmga1 |
| Gene name | high mobility group AT-hook 1 |
| Allele symbol | |
| Allele name | high mobility group AT-hook 1, targeted mutation 1, Institute of Molecular Embryology and Genetics. |
| MGI | MGI:96160, |
| Chromosome | 17 (14.5) (A3.3) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Hmga1-EGFP-A | TCATCCCCCTTTTGCAGAGG |
| Hmga1-EGFP-B | CGCTCCTGGACGTAGCCTTC |
| Hmga1-EGFP-C | TACCTGCCCATTCGACCACC |
| Hmga1-EGFP-D | ACAGGGACTGAGCCGAATCC |
| Author | Li-Mei Chen, Cindy Wang, Mengqian Chen, Matthew R. Marcello, Julie Chao, Lee Chao and Karl X. Chai |
| Title | Prostasin attenuates inducible nitric oxide synthase expression in lipopolysaccharide-induced urinary bladder inflammation |
| Journal | Am J Physiol Renal Physiol |
| Volume | 291 |
| Page | F567-F577 |
| Year | 2006 |
| PMID |
| Disease name, Applicable field |