| CARD ID | 1884 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Spink3tm1(SPINK1) Card | |
| Internal Code | SPINK1 knockin mouse | |
| Submitter | Ken-ichi YAMAMURA | |
| Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Center for Animal Resources & Development (CARD), Kumamoto University |
| Organization code | Card | |
| Developer | Ken-ichi Yamamura | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Spink 1 |
| Gene name | serine protease inhibitor Kazal type 1 |
| Allele symbol | |
| Allele name | serine protease inhibitor Kazal type 1, targeted mutation 1, Naomi Nakagata, Center for Animal Resources and Development |
| MGI | MGI:106202, |
| Chromosome | 18 (23.47 ) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| SPINK1-1-1 | gaaggtaacaggcatctttcttctc |
| SPINK1-1-2 | atctctttacctctcttcccaggg |
| Author | Wang J, Ohmuraya M, Hirota M, Baba H, Zhao G, Takeya M, Araki K, Yamamura K |
| Title | Expression pattern of serine protease inhibitor kazal type 3 (Spink3) during mouse embryonic development. |
| Journal | Histochem Cell Biol. |
| Volume | 130 |
| Page | 387-97 |
| Year | 2008 |
| PMID |
| Author | Ohmuraya M, Hirota M, Araki M, Mizushima N,Matsui M, Mizumoto T, Haruna K, Kume S, Takeya M, Ogawa M, Araki K, Yamamura K. |
| Title | Autophagic cell death of pancreatic acinar cells in serine protease inhibitor kazal type 3-deficient mice. |
| Journal | Gastroenterology |
| Volume | Aug;129(2) |
| Page | 696-705 |
| Year | 2005 |
| PMID | 16083722 |
| Disease name, Applicable field | Laboratory-animal Science |