| CARD ID | 1882 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Ffar1tm1Gdds | |
| Internal Code | gpr40KOB6 | |
| Submitter | Akira Hirasawa | |
| Submitter affiliation or code | Department of Genomic Drug Discovery Science Graduate School of Pharmaceutical Sciences, Kyoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | Gdds | |
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ffar1 |
| Gene name | Ffar1, free fatty acid receptor 1 |
| Allele symbol | Ffar1tm1Gdds |
| Allele name | targeted mutation 1; Gozoh Tsujimoto |
| MGI | MGI:2684079, |
| Chromosome | 7 (19.25 ) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| 40-S1 | TAGGACTGGCTTCTGGTGCT |
| 40-AS2,3primer-neo(primer3) | CCTCCTGAGTTGTGGTGGAT,GGCTATTCGGCTATGACTGG |
| Disease name, Applicable field | Obesity, Diabetes |