| CARD ID | 1880 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Ffar2tm1Gdds | |
| Internal Code | gpr43KO | |
| Submitter | Kimura Ikuo | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | Gdds | |
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ffar2 (synonym to Gpr43) |
| Gene name | free fatty acid receptor 2 |
| Allele symbol | Ffar2tm1Gdds |
| Allele name | targeted mutation 1; Gozoh Tsujimoto |
| MGI | |
| Chromosome | 7 (19.25) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| out43-s | AAGGGAACCGATCACAGCTA |
| out43-as,3primer-neo(primer3) | CGGCATAACAGTGGAGACAA,GGCTATTCGGCTATGACTGG |
| Disease name, Applicable field | Obesity, Diabetes |