| CARD ID | 1865 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;CB-Bnc2tm4(Tdisco)Card | |
| Internal Code | TdiscoKI | |
| Submitter | Masatake ARAKI | |
| Submitter affiliation or code | Gene Technology Center, IRDA, Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | Card | |
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Bnc2 |
| Gene name | Basonuclin 2 |
| Allele symbol | Bnc2tm3(Bnc2)12Card |
| Allele name | Basonuclin 2; targeted mutation 3, Center for Animal Resources & Development |
| MGI | MGI:2443805, |
| Chromosome | 4 (39.76) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| SA-11 | CCCGAAAACCAAAGAAGAAG |
| Tcbnc2-2 | AGATGTCGCGTTCCCAACTTG |
| Disease name, Applicable field | Development |