| CARD ID | 1838 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6-Mir142tm1Card | |
| Internal Code | 21-KBW111reKO17 | |
| Submitter | Masatake ARAKI | |
| Submitter affiliation or code | Gene Technology Center, IRDA, Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | Card | |
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Mir142 |
| Gene name | microRNA 142 |
| Allele symbol | |
| Allele name | |
| MGI | MGI:2676827, |
| Chromosome | 11 (52.21) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Z-1 | GCGTTACCCAACTTAATCG |
| Z-2 | TGTGAGCGAGTAACAACCCG |
| Author | Tanaka, K., et al. |
| Title | MiR-142 is required for Staphylococcus aureus clearance at skin wound sites via small GTPase-mediated regulation of the neutrophil actin cytoskeleton. |
| Journal | J. Invest, Dermatol. |
| Volume | 137 |
| Page | 931-940 |
| Year | 2017 |
| PMID |
| Disease name, Applicable field | Development, Immunology, Dermatology, Hematology |