| CARD ID | 1836 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(Has2) | |
| Internal Code | Has2 cTg (C57BL/6) | |
| Submitter | Itano Naoki | |
| Submitter affiliation or code | Department of Molecular Biosciences,Faculty of Life Sciences,Kyoto Sangyo University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Kyoto Sangyo University |
| Organization code | ||
| Developer | Naoki Itano | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Has2 |
| Gene name | Hyaluronan Synthase 2 |
| Allele symbol | Tg(Has2) |
| Allele name | trasgene insertion |
| MGI | MGI:107821, |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| mHAS2 S-2 primer | GACCTGGTGAGACAGAAGAGTCCC |
| mHAS2 R-798 primer | TATATTAAAAGCCATCCAGTATCTCACG |
| Author | Koyama H, et al. |
| Title | Hyperproduction of hyaluronan in neu-induced mammary tumor accelerates angiogenesis through stromal cell recruitment: possible involvement of versican /PG-M. |
| Journal | Am. J. Pathol. |
| Volume | 170 |
| Page | 1086-1099 |
| Year | 2007 |
| PMID |
| Author | Koyama H, et al. |
| Title | Significance of tumor-associated stroma in promotion of intratumoral lymphangiogenesis : pivotal role of a hyaluronan-rich tumor |
| Journal | Am. J. Pathol. |
| Volume | 172 |
| Page | 179-193 |
| Year | 2008 |
| PMID |
| Disease name, Applicable field | Others, Development, cancer |