| CARD ID | 1824 | |
| Type of strain | Transgenic. | |
| Strain name | B6;D2-Tg(CAG/CAT-tvA)P2Tama | |
| Internal Code | B6;D2-Tg(CAG/CAT/tvA)P2 | |
| Submitter | Esumi Shigeyuki | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
Need acknowledgement in publishing paper. |
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | Deparatment of Morphological Neural Science, Graduate School of Medicine, Kumamoto University |
| Organization code | Tama | |
| Developer | Nobuaki Tamamaki | |
| Origin (From other organizations) | Organization | Kyoto Univ. |
| Organization code | ||
| Developer | Nobuaki tamamaki | |
| Year introduced | 2004 / 6 | |
| Introduced Generation | ||
| Remarks | Need contact to Nobuaki Tamamaki ( tamamaki@kumamoto-u.ac.jp ). Need acknowledgement in publication. | |
| Gene symbol | tvA |
| Gene name | tv-A800 |
| Allele symbol | Tg(CAG/CAT-tvA)P2Tama |
| Allele name | transgene insertion P2, Nobuaki Tamamaki |
| MGI | |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| tvaup | ATGGCGCGGCTGCTGCCCGCGCT |
| tvalow | TTATCAGTCCCATCTCACCAGCT |
| Author | Shengxi Wu, Shigeyuki Esumi, Keisuke Watanabe, Jing Chen, Kouichi C. Nakamura, Kazuhiro Nakamura, Kouhei Kometani, Nagahiro Minato, Yuchio Yanagawa, Kaori Akashi, Kenji Sakimura, Takeshi Kaneko and Nobuaki Tamamaki |
| Title | Tangential migration and proliferation of intermediate progenitors of GABAergic neurons in the mouse telencephalon |
| Journal | Development |
| Volume | 138 |
| Page | 2499-2509 |
| Year | 2011 |
| PMID |
| Disease name, Applicable field | Molecular biology, Development, Laboratory-animal Science, Cell biology, Neurobiology |