| CARD ID | 1816 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Mll1tm1dexon11 | |
| Internal Code | Mlldexon11 | |
| Submitter | Yokoyama Akihiko | |
| Submitter affiliation or code | Kyoto University Graduate School of Medicine Medical Innovation Center Laboratory for Malignancy Control Research DSK project | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Stanford University Medical School |
| Organization code | Mlc | |
| Developer | Michael L. Cleary | |
| Year introduced | 2009 / 5 | |
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Mll1 |
| Gene name | myeloid/lymphoid or mixed-lineage leukemia 1 |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | 9 , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| dex8.2.fwd | tgaactggtgggaaagcacagacatcctga |
| dex8.2.rev | agagatggttcagcggttaagagctctgac |
| Disease name, Applicable field | Aging, Molecular biology, Cell biology, cancer, Endocrine Disorders, Hematology |