| CARD ID | 1790 | |
| Type of strain | Targeted mutant. | |
| Strain name | Alk2-flox | |
| Internal Code | Alk2-flox mouse | |
| Submitter | Esumi Shigeyuki | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
You need MTA with Michigan Univ. |
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | University of Michigan |
| Organization code | ||
| Developer | Vesa Kaartinen | |
| Year introduced | 2011 / 4 | |
| Introduced Generation | ||
| Remarks | Need MTA with University of Michigan | |
| Gene symbol | Acvr1 (synonymous to Alk2) |
| Gene name | Activin receptor type 1 |
| Allele symbol | Alk2tm1 |
| Allele name | Activin receptor type 1; targeted mutation 1 |
| MGI | |
| Chromosome | 2 (33.05) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Alk2I7F (Alk2-Intron7-Forward) | CCCCCATTGAAGGTTTAGAGAGAC |
| Alk2I7R2 (Alk2-Intron7-Reverse2) | CTAAGAGCCATGACAGAGGTTG |
| Disease name, Applicable field | Development, Urology, Neurobiology, Digestive Disorders, Hematology, Osteosis |