| CARD ID | 1769 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;CB-Bcn2tm1(Bnc1)11Card | |
| Internal Code | B6;CB-Bcn2tm1(Bnc1)11Card | |
| Submitter | Masatake ARAKI | |
| Submitter affiliation or code | Gene Technology Center, IRDA, Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Bnc2 |
| Gene name | Basonuclin 2 |
| Allele symbol | Bnc2tm1(Bnc1)11Card |
| Allele name | Basonuclin 2; targeted mutation 1, Center for Animal Resources and Development |
| MGI | |
| Chromosome | 4 (39.76) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| SA-11 | CCCGAAAACCAAAGAAGAAG |
| Bnc1-2 | CTTGGTCTCTCCAAAGCGAAG |
| Author | Tashiro, F., Kanai-Azuma, M., Miyazaki, S., Kato, M., Tanaka, T., Toyoda , S., Yamato, E., Kawakami, H., Miyazaki, T. and Miyazaki, J. |
| Title | Maternal-effect gene Ces5/Ooep/Moep19/Floped is essential for oocyte cytoplasmic lattice formation and embryonic development at the maternal-zygotic stage transition |
| Journal | Genes Cells |
| Volume | 15 |
| Page | 813-828 |
| Year | 2010 |
| PMID |
| Disease name, Applicable field | Development |