| CARD ID | 1688 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6.129-Cckartm1 | |
| Internal Code | C57BL/6-Cckartm1 | |
| Submitter | Okamura Takeshi | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | National Kyushu Cancer Center |
| Organization code | ||
| Developer | Soich Takiguchi | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Cckar |
| Gene name | Cholecystokinin A receptor |
| Allele symbol | Cckartm1 |
| Allele name | Cholecystokinin A receptor; targeted mutation 1, Soichi Takiguchi |
| MGI | |
| Chromosome | 5 (29.52) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| CCKA-1 | AGTGAGCCATTCACCAGCTCGCCAG |
| LacZ-1 | CGCTATTACGCCAGCTGGCGAAAGG |
| Disease name, Applicable field | Physiology, cancer, Neurobiology, Metabolism |