| CARD ID | 1748 | |
| Type of strain | Gene trap. | |
| Strain name | B6; CB-Fzr1/Cdh1GT(Cdh1 KI) | |
| Internal Code | Fzrcdh1(GT(ResP17)) | |
| Submitter | Saya Hideyuki | |
| Submitter affiliation or code | Division of Gene Regulation, Institute for Advanced Medical Research,Keio University School of Medicine | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Fzr1 |
| Gene name | fizzy/cell division cycle 20 related 1 (Drosophila) |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1926790, |
| Chromosome | 10 , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| FzrORF-s | atggaccaggactatgagcg |
| FzrORF-as | ctatcggatccgggtgaagag |
| Author | Naoe H, Araki K, Nagano O, Kobayashi Y, Ishizawa J, Chiyoda T, Shimizu T, Sasaki Y, Yamamura KI, Saya H, Kuninaka S |
| Title | The anaphase-promoting complex/cyclosome activator Cdh1 modulates RhoGTPase by targeting p190 RhoGAP for degradation. |
| Journal | Mol. Cell. Biol. |
| Volume | 30 |
| Page | 3994-4005 |
| Year | 2010 |
| PMID |
| Disease name, Applicable field |