| CARD ID | 1594 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(Ccl17) | |
| Internal Code | TARC-Tg | |
| Submitter | - - | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
No condition
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | University of Tokyo, Department of Dermatology |
| Organization code | ||
| Developer | Yuichiro Tsunemi | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Tarc(synonym to Ccl17 |
| Gene name | Tarc(synonym to chemokine (C-C motif) ligand 17) |
| Allele symbol | Tg(Ccl17) |
| Allele name | transgene insertion |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| TARC-F | ACACCTCCCCCTGTGAATCA |
| TARC-R | TTTCACCAATCTGATGGCCT |
| Disease name, Applicable field | Immunology, Dermatology |