| CARD ID | 1431 | |
| Type of strain | Targeted mutant. | |
| Strain name | 129.Cg-Atp1a2tm2Kwk | |
| Internal Code | tmNKwk | |
| Submitter | KAWAKAMI KIYOSHI | |
| Submitter affiliation or code | jichi medical university | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Jichi Medical University |
| Organization code | ||
| Developer | Kiyoshi Kawakami | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Atp1a2 |
| Gene name | ATPase, Na+/K+ transporting, alpha 2 polypeptide |
| Allele symbol | Atp1a2tm2Kwk |
| Allele name | ATPase, Na+/K+ transporting, alpha 2 polypeptide; targeted mutation 2, Kiyoshi Kawakami |
| MGI | |
| Chromosome | 1 (79.6) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| 9538-N4 | GGGAGAGACAGACACGGAGGAAGATGAC |
| 9537-NeoR3 | gcctgcttgccgaatatcatggtggaaaat |
| Disease name, Applicable field | Physiology, Anatomy, Dermatology, Neurobiology, Metabolism |