| CARD ID | 1371 | |
| Type of strain | Transgenic. | |
| Strain name | B6;ICR-Tg(Foxa2-mRFP) | |
| Internal Code | Tg(Foxa2-mRFP) | |
| Submitter | Kume Shoen | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Kumamoto University |
| Organization code | Card | |
| Developer | Kume Shoen | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | mRFP |
| Gene name | monomeric red fluorescent protein |
| Allele symbol | Tg(Foxa2-mRFP) |
| Allele name | transgene insertion, Shoen Kume |
| MGI | |
| Chromosome | 2 (G3) , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| mRFP-U | AGGACGGCGAGTTCATCTAC |
| mRFP-D | TGGTGTAGTCCTCGTTGTGG |
| Disease name, Applicable field | Development |