| CARD ID | 1289 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6J-Tg(mGluR6-hrGFP)26Nkj | |
| Internal Code | Tg(mGluR6-hrGFP)26Nkj) | |
| Submitter | - - | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | ||
| Origin (In-house) | Organization | Department of Biological Sciences, Faculty of Medicine, Kyoto University |
| Organization code | Nkj | |
| Developer | Yoshiaki Nakajima | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | hrGFP |
| Gene name | humanized Renilla reniformis green fluorescent protein |
| Allele symbol | Tg(mGluR6-hrGFP)26Nkj |
| Allele name | transgene insertion 26, Yoshiaki Nakajima |
| MGI | |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| hrGFPf2 | GCAACCAGCTGGTGCAGATC |
| hrGFPr2 | TCCTCCACGTAGGTCTTCTC |
| Disease name, Applicable field | Physiology, Anatomy, Development, Neurobiology, Metabolism |