| CARD ID | 1203 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129Sv-Ednrbtm1 | |
| Internal Code | Ednrb-floxed | |
| Submitter | Kato Masashi | |
| Submitter affiliation or code | Nagoya University Graduate School of Medicine Department of Occupational and Environmental Health | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | University of Wisconsin |
| Organization code | ||
| Developer | Jeffery W. Walker | |
| Year introduced | 2008 / 3 | |
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ednrb |
| Gene name | endothelin receptor type B |
| Allele symbol | Ednrbtm1 |
| Allele name | targeted mutation 1 |
| MGI | MGI:102720, |
| Chromosome | 14 (51.0) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| EdnrB-FL-F | TGGAATGTGTGCGAGGCC |
| EdnrB-FL-R | CAGCCAGAACCACAGAGACCACCC |
| Disease name, Applicable field | Development, cancer, Dermatology, Metabolism |